pMH-macroHC
(Plasmid
#82337)
-
PurposeProvides a C-terminal macro domain and 6xHis tag for expression in E. coli
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 82337 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepET-24d modified
-
Backbone manufacturerEMBL pepcore
- Backbone size w/o insert (bp) 5502
- Total vector size (bp) 6331
-
Modifications to backboneInsertion of a macro domain fusion tag
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberLow Copy
Gene/Insert
-
Gene/Insert nameSPX domain of the Vacuolar Transporter Chaperone 4
-
Alt nameVTC4
-
SpeciesS. cerevisiae (budding yeast)
-
Insert Size (bp)829
-
MutationTruncated protein, amino acids 1-178
-
GenBank IDNM_001181446
-
Entrez GeneVTC4 (a.k.a. YJL012C, PHM3, YJL012C-A)
-
Tags
/ Fusion Proteins
- macro domain of human histone macroH2A1.1 (C terminal on backbone)
- 6xHis non-cleavable (C terminal on backbone)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site XbaI (not destroyed)
- 3′ cloning site NcoI (not destroyed)
- 5′ sequencing primer TGCGTCCGGCGTAGAGGATCGAGATCT
- 3′ sequencing primer CAGCTTCCTTTCGGGCTTTGTTAGCAG (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pMH-macroHC was a gift from Michael Hothorn (Addgene plasmid # 82337 ; http://n2t.net/addgene:82337 ; RRID:Addgene_82337) -
For your References section:
The macro domain as fusion tag for carrier-driven crystallization. Wild R, Hothorn M. Protein Sci. 2016 Oct 24. doi: 10.1002/pro.3073. 10.1002/pro.3073 PubMed 27774698