pSB7
(Plasmid
#82029)
-
PurposeHybrid Tar[1-43]-CitA[55-173]-Tar[184-553] expression plasmid
-
Depositing Lab
-
Publication
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 82029 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepKG116
- Backbone size w/o insert (bp) 4211
- Total vector size (bp) 5763
Growth in Bacteria
-
Bacterial Resistance(s)Chloramphenicol, 25 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberLow Copy
Gene/Insert
-
Gene/Insert nameEncodes the hybrid receptor of E. coli chemoreceptor Tar and histidine kinase CitA: Tar[1-43]-CitA[55-173]-Tar[184-553]
-
SpeciesE. coli
-
Insert Size (bp)1599
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site NdeI (not destroyed)
- 3′ cloning site BamHI (not destroyed)
- 5′ sequencing primer CGGGCGCAATATTCATGTTG (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pSB7 was a gift from Victor Sourjik (Addgene plasmid # 82029 ; http://n2t.net/addgene:82029 ; RRID:Addgene_82029) -
For your References section:
Engineering Hybrid Chemotaxis Receptors in Bacteria. Bi S, Pollard AM, Yang Y, Jin F, Sourjik V. ACS Synth Biol. 2016 Jun 10. 10.1021/acssynbio.6b00053 PubMed 27285081