Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pACSA_PcptOO_YFP_PMB2__LacIWF
(Plasmid #82020)

Full plasmid sequence is not available for this item.

Loading...

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 82020 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pACSA
  • Total vector size (bp) 6368

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    YFP
  • Promoter Pcptoo

Cloning Information

  • Cloning method Gibson Cloning
  • 5′ sequencing primer GCTTCCGGCTCGTATGTTGTG
  • 3′ sequencing primer TTGGGTAACGCCAGGGT
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pACSA_PcptOO_YFP_PMB2__LacIWF was a gift from Brian Pfleger (Addgene plasmid # 82020 ; http://n2t.net/addgene:82020 ; RRID:Addgene_82020)
  • For your References section:

    Synthetic biology toolbox for controlling gene expression in the cyanobacterium Synechococcus sp. strain PCC 7002. Markley AL, Begemann MB, Clarke RE, Gordon GC, Pfleger BF. ACS Synth Biol. 2015 May 15;4(5):595-603. doi: 10.1021/sb500260k. Epub 2014 Sep 25. 10.1021/sb500260k PubMed 25216157