-
Purpose(Empty Backbone) Lentivirus enhancer assay plasmid that contains a minimal promoter (mP) and a EGFP reporter gene.
-
Depositing Lab
-
Publication
-
Sequence Information
Ordering
This material is available to academics and nonprofits only.
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 81225 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 | |
Backbone
-
Vector backbonepLB
- Backbone size (bp) 7800
-
Vector typeLentiviral
- Promoter Derived from pGL4.23
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Cloning Information
- Cloning method Restriction Enzyme
- 5′ sequencing primer GCTTCTTGTGTATATCCGGTC (Common Sequencing Primers)
Resource Information
-
Articles Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
How to cite this plasmid
( Back to top)
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pLS-mP was a gift from Nadav Ahituv (Addgene plasmid # 81225 ; http://n2t.net/addgene:81225 ; RRID:Addgene_81225) -
For your References section:
A systematic comparison reveals substantial differences in chromosomal versus episomal encoding of enhancer activity. Inoue F, Kircher M, Martin B, Cooper GM, Witten DM, McManus MT, Ahituv N, Shendure J. Genome Res. 2016 Nov 9. pii: gr.212092.116. 10.1101/gr.212092.116 PubMed 27831498
Map uploaded by the depositor.
