pCALNL_chr13_102010574-102010650
(Plasmid
#81213)
-
PurposepCALNL reporter contains two target sites consisting of PAM Cas9 site-gix psuedo site-Cas9 site-PAM that match region in centromeres of chromosomes 13 (numbers in common name refers to pos. in hg38)
-
Depositing Lab
-
Sequence Information
Ordering
This material is available to academics and nonprofits only.
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 81213 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 | |
Backbone
-
Vector backbonepCALNL
- Backbone size w/o insert (bp) 7000
- Total vector size (bp) 7000
-
Vector typeMammalian Expression
-
Selectable markersNeomycin (select with G418)
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namegix-Neo-gix deletion cassette upstream of EGFP
-
SpeciesSynthetic
- Promoter pCBa
Cloning Information
- Cloning method Unknown
- 5′ sequencing primer GCCTTCTTCTTTTTCCTACAGC
- 3′ sequencing primer CGCATCGAGCGAGCAC (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
How to cite this plasmid
( Back to top)
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pCALNL_chr13_102010574-102010650 was a gift from David Liu (Addgene plasmid # 81213 ; http://n2t.net/addgene:81213 ; RRID:Addgene_81213) -
For your References section:
A programmable Cas9-serine recombinase fusion protein that operates on DNA sequences in mammalian cells. Chaikind B, Bessen JL, Thompson DB, Hu JH, Liu DR. Nucleic Acids Res. 2016 Aug 11. pii: gkw707. 10.1093/nar/gkw707 PubMed 27515511
Map uploaded by the depositor.
