pETconNK-TEM1(S70A,D179G)
(Plasmid #81166)

• Purpose: pETconNK with TEM1(S70A,D179G) beta-lactamase
• Depositing Lab: Timothy Whitehead
• Publication: Klesmith et al Proc Natl Acad Sci U S A. 2017 Feb 14. pii: 201614437. doi: 10.1073/pnas.1614437114.

Backbone

• Vector backbone: pETconNK
• Backbone size w/o insert (bp): 6109
• Total vector size (bp): 6898
• Modifications to backbone: Starting with pETcon the ampicillin resistance gene was swapped with kanamycin with the BbvCI nicking site 3' of the KanR gene. The nicking sequence CCTCAGCAA is on the coding strand.
• Vector type: Bacterial Expression, Yeast Expression
• Selectable markers: TRP1

Growth in Bacteria

• Bacterial Resistance(s): Kanamycin, 50 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: TEM-1 beta-lactamase
• Species: Synthetic
• Insert Size (bp): 789
• Mutation: Deleted the sec transport tag. Plasmid encodes H26 to W290. Mutations S70A, D179G.
• GenBank ID: WP_054579850
• Promoter: gal1
• Tag / Fusion Protein:
  • c-myc (C terminal on backbone)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: NdeI (not destroyed)
• 3′ cloning site: XhoI (not destroyed)
• 5′ sequencing primer: GGACAATAGCTCGACGATTGAAGGTAGATACCCATA
• 3′ sequencing primer: TAATACGACTCACTATAGG

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry