pSALECTNK-TEM1(S70A,D179G)/csTEM1
(Plasmid #81163)

• Purpose: pSALECT plasmid with TEM-1 beta-lactamase fused to TEM-1
• Depositing Lab: Timothy Whitehead
• Publication: Klesmith et al Proc Natl Acad Sci U S A. 2017 Feb 14. pii: 201614437. doi: 10.1073/pnas.1614437114.

Backbone

• Vector backbone: pSALECT
• Backbone size w/o insert (bp): 3224
• Total vector size (bp): 4013
• Modifications to backbone: Addition of a codon-swapped fusion beta-lactamase with a c-terminal Hix6x tag followed by a BbvCI nicking site.
• Vector type: Bacterial Expression

Growth in Bacteria

• Bacterial Resistance(s): Chloramphenicol, 25 μg/mL
• Growth Temperature: 30°C
• Growth Strain(s): DH5alpha
• Growth instructions: For plasmid production a general cloning strain with this plasmid can grown at 30 or 37oC. For selection on ampicillin the temperature is limited to 30oC in a strain that has lacI knocked-out (the strain MC4100 is best suited for this).
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: TEM-1 beta-lactamase
• Species: Synthetic
• Insert Size (bp): 789
• Mutation: Deleted the sec transport tag. Plasmid encodes H26 to W290. Mutations S70A, D179G.
• GenBank ID: WP_054579850
• Promoter: lac promoter
• Tags / Fusion Proteins:
  • Codon swapped TEM-1 from H26 to W290 (C terminal on backbone)
  • His6x (C terminal on backbone)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: NdeI (not destroyed)
• 3′ cloning site: XhoI (not destroyed)
• 5′ sequencing primer: GGTTTCCCGACTGGAAAG
• 3′ sequencing primer: AGGGCAGGGTCGTTAAATAGC

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry