pSicoR-sh4EBP2
(Plasmid #81121)

• Purpose: expresses an shRNA targeting murine 4E-BP2
• Depositing Lab: Angelique Bordey
• Publication: Hartman et al Cell Rep. 2013 Oct 31;5(2):433-44. doi: 10.1016/j.celrep.2013.09.017. Epub 2013 Oct 17.

Backbone

• Vector backbone: pSicoR
• Backbone manufacturer: Jacks Lab (MIT)
• Backbone size w/o insert (bp): 7567
• Total vector size (bp): 7609
• Vector type: Mammalian Expression, Lentiviral, RNAi, Cre/Lox

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): NEB Stable
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: 4E-BP2 shRNA
• Alt name: Eif4ebp2 shRNA
• gRNA/shRNA sequence: CGCCTTAATTGAAGACTCCAA
• Species: M. musculus (mouse)
• Entrez Gene: Eif4ebp2 (a.k.a. 2810011I19Rik, 4E-BP2, AA792569, BC010348, PHAS-II)
• Promoter: U6

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: HpaI (destroyed during cloning)
• 3′ cloning site: XhoI (not destroyed)
• 5′ sequencing primer: mU6-F

Resource Information

• A portion of this plasmid was derived from a plasmid made by: pSicoR was obtained from Addgene (plasmid 11579). shRNA insert was synthesized independently but is based on a target sequence from Broad/RNAi Platform (TRCN0000075614)

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

pSicoR allows for expression of the 4E-BP2 shRNA in the absence of Cre. Expression of Cre turns off shRNA expression. These plasmids were also used in the following publication "Normalizing translation through 4E-BP prevents mTOR-driven cortical mislamination and ameliorates aberrant neuron integration. Lin TV, Hsieh L, Kimura T, Malone TJ, Bordey A. Proc Natl Acad Sci U S A. 2016 Oct 4;113(40):11330-11335."