pSico-shRheb
(Plasmid #81087)

• Purpose: conditional expression of an shRNA targeting murine Rheb
• Depositing Lab: Angelique Bordey
• Publication: Hartman et al Cell Rep. 2013 Oct 31;5(2):433-44. doi: 10.1016/j.celrep.2013.09.017. Epub 2013 Oct 17.

Backbone

• Vector backbone: pSico
• Backbone manufacturer: Jacks Lab (MIT)
• Backbone size w/o insert (bp): 7566
• Total vector size (bp): 7608
• Vector type: Mammalian Expression, Lentiviral, RNAi, Cre/Lox

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): NEB Stable
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: Rheb shRNA
• gRNA/shRNA sequence: CCCGTCATCCTTGAAGATAAA
• Species: M. musculus (mouse)
• Entrez Gene: Rheb (a.k.a. Rheb1)
• Promoter: U6

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: HpaI (destroyed during cloning)
• 3′ cloning site: XhoI (not destroyed)
• 5′ sequencing primer: EGFP-C

Resource Information

• A portion of this plasmid was derived from a plasmid made by: pSico was obtained from Addgene (plasmid 11578). shRNA insert was synthesized independently but is based on a target sequence from the Broad RNAi Platform (TRCN0000075603).

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

pSico allows for conditional (Cre-Lox), stable expression of shRheb. Cre expression excises GFP and allows for shRheb expression.