pconst #6-RFP
(Plasmid
#81080)
-
Purposeconstitutive promoter expressing RFP, biobrick construction
-
Depositing Labs
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 81080 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepBbA0k-RFP
- Backbone size w/o insert (bp) 2099
- Total vector size (bp) 2777
-
Vector typeP15A origin, Constitutive promoter, kanR
-
Selectable markersKan
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Growth instructionsmedium copy
-
Copy numberLow Copy
Gene/Insert
-
Gene/Insert nameRFP
-
Insert Size (bp)678
- Promoter Constitutive Promoter - BBa_J23117
Cloning Information
- Cloning method Unknown
- 5′ sequencing primer ttgacagctagctcagtcctagggattgtgctagc (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pconst #6-RFP was a gift from Paul Adams & Jay Keasling (Addgene plasmid # 81080 ; http://n2t.net/addgene:81080 ; RRID:Addgene_81080) -
For your References section:
Engineering dynamic pathway regulation using stress-response promoters. Dahl RH, Zhang F, Alonso-Gutierrez J, Baidoo E, Batth TS, Redding-Johanson AM, Petzold CJ, Mukhopadhyay A, Lee TS, Adams PD, Keasling JD. Nat Biotechnol. 2013 Nov;31(11):1039-46. doi: 10.1038/nbt.2689. Epub 2013 Oct 20. 10.1038/nbt.2689 PubMed 24142050