Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pLJM1-PCYT2
(Plasmid #81074)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 81074 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pLJM1
  • Backbone manufacturer
    Sabatini lab (Addgene #19313)
  • Backbone size w/o insert (bp) 7400
  • Total vector size (bp) 8551
  • Modifications to backbone
    None
  • Vector type
    Mammalian Expression, Lentiviral
  • Selectable markers
    Puromycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    30°C
  • Growth Strain(s)
    NEB Stable
  • Growth instructions
    or use stbl2 cells
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    phosphate cytidylyltransferase 2, ethanolamine
  • Alt name
    PCYT2
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    1170
  • GenBank ID
    NM_002861.4
  • Entrez Gene
    PCYT2 (a.k.a. ET, SPG82)
  • Tag / Fusion Protein
    • FLAG (N terminal on backbone)

Cloning Information

  • Cloning method Gibson Cloning
  • 5′ sequencing primer TTCCAAAATGTCGTAACAACTCCG
  • 3′ sequencing primer ATGTCTACTATTCTTTCCCCTGCA
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pLJM1-PCYT2 was a gift from Erin O'Shea (Addgene plasmid # 81074 ; http://n2t.net/addgene:81074 ; RRID:Addgene_81074)
  • For your References section:

    The anticancer natural product ophiobolin A induces cytotoxicity by covalent modification of phosphatidylethanolamine. Chidley C, Trauger SA, Birsoy K, O'Shea EK. Elife. 2016 Jul 12;5. pii: e14601. doi: 10.7554/eLife.14601. 10.7554/eLife.14601 PubMed 27403889