pLJM1-PCYT2
(Plasmid
#81074)
-
PurposeExpresses PCYT2 in mammalian cells
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 81074 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepLJM1
-
Backbone manufacturerSabatini lab (Addgene #19313)
- Backbone size w/o insert (bp) 7400
- Total vector size (bp) 8551
-
Modifications to backboneNone
-
Vector typeMammalian Expression, Lentiviral
-
Selectable markersPuromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature30°C
-
Growth Strain(s)NEB Stable
-
Growth instructionsor use stbl2 cells
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namephosphate cytidylyltransferase 2, ethanolamine
-
Alt namePCYT2
-
SpeciesH. sapiens (human)
-
Insert Size (bp)1170
-
GenBank IDNM_002861.4
-
Entrez GenePCYT2 (a.k.a. ET, SPG82)
-
Tag
/ Fusion Protein
- FLAG (N terminal on backbone)
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer TTCCAAAATGTCGTAACAACTCCG
- 3′ sequencing primer ATGTCTACTATTCTTTCCCCTGCA (Common Sequencing Primers)
Resource Information
-
Article Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pLJM1-PCYT2 was a gift from Erin O'Shea (Addgene plasmid # 81074 ; http://n2t.net/addgene:81074 ; RRID:Addgene_81074) -
For your References section:
The anticancer natural product ophiobolin A induces cytotoxicity by covalent modification of phosphatidylethanolamine. Chidley C, Trauger SA, Birsoy K, O'Shea EK. Elife. 2016 Jul 12;5. pii: e14601. doi: 10.7554/eLife.14601. 10.7554/eLife.14601 PubMed 27403889