Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

FLAG-KLF12/pcDNA3.1-Neo
(Plasmid #81069)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 81069 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pcDNA3
  • Vector type
    Mammalian Expression
  • Selectable markers
    Neomycin (select with G418)

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    FLAG-KLF12
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    1300
  • Entrez Gene
    KLF12 (a.k.a. AP-2rep, AP2REP, HSPC122)
  • Tag / Fusion Protein
    • FLAG (N terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site EcoRI (unknown if destroyed)
  • 3′ cloning site EcoRI (unknown if destroyed)
  • 5′ sequencing primer tgagtcatgttcaccgcatc
  • 3′ sequencing primer tgttgcatccctcaaaatca
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    FLAG-KLF12/pcDNA3.1-Neo was a gift from Julian Downward (Addgene plasmid # 81069 ; http://n2t.net/addgene:81069 ; RRID:Addgene_81069)
  • For your References section:

    Tumour-suppression function of KLF12 through regulation of anoikis. Godin-Heymann N, Brabetz S, Murillo MM, Saponaro M, Santos CR, Lobley A, East P, Chakravarty P, Matthews N, Kelly G, Jordan S, Castellano E, Downward J. Oncogene. 2016 Jun 23;35(25):3324-34. doi: 10.1038/onc.2015.394. Epub 2015 Oct 12. 10.1038/onc.2015.394 PubMed 26455320