pEN_TmiRc3_shURB5
(Plasmid #81066)

• Purpose: Gateway entry vector encoding shRNA to UBR5
• Depositing Lab: Darren Saunders
• Publication: Shearer et al Mol Biol Cell. 2018 May 9:mbcE17040248. doi: 10.1091/mbc.E17-04-0248.

Backbone

• Vector backbone: pEN_TmiRc3 (pENTR1A-Gent)
• Backbone manufacturer: ATCC 10326362
• Backbone size w/o insert (bp): 4232
• Total vector size (bp): 4295
• Vector type: Cloning

Growth in Bacteria

• Bacterial Resistance(s): Gentamicin, 10 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: shRNA targeting UBR5
• gRNA/shRNA sequence: CGCAGTGAATGTAGATTCCAAA
• Species: Synthetic
• Promoter: N/A

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: BfuA1 (unknown if destroyed)
• 3′ cloning site: BfuA1 (unknown if destroyed)
• 5′ sequencing primer: Unknown
• 3′ sequencing primer: Unknown

Resource Information

• A portion of this plasmid was derived from a plasmid made by: pEN_TmiRc3 was a gift from Iain Fraser (Addgene plasmid # 25748)

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

For use with pSLIK lentiviral system. Original publication:
A single lentiviral vector platform for microRNA-based conditional RNA interference and coordinated transgene expression. Shin KJ, Wall EA, Zavzavadjian JR, Santat LA, Liu J, Hwang JI, Rebres R, Roach T, Seaman W, Simon MI, Fraser ID. Proc Natl Acad Sci U S A. 2006 Sep 12. 103(37):13759-64. 10.1073/pnas.0606179103

shRNA sequence obtained from the RNAi Codex:
A. Olson, N. Sheth, J. S. Lee, G. Hannon and R. Sachidanandam (2005) RNAi Codex: a portal/database for short-hairpin RNA (shRNA) gene-silencing constructs. Nucleic Acids Research, 34, D153-D157