Skip to main content
Addgene

pGEX4T-hLIG3
(Plasmid #81055)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 81055 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pGEX-4T-3
  • Backbone manufacturer
    GE Healthcare Life Sciences
  • Backbone size w/o insert (bp) 4968
  • Total vector size (bp) 7766
  • Vector type
    Bacterial Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    DNA ligase 3
  • Species
    H. sapiens (human)
  • GenBank ID
    NM_002311.4
  • Entrez Gene
    LIG3 (a.k.a. LIG2, LIG3alpha, MTDPS20)
  • Promoter tac
  • Tag / Fusion Protein
    • GST (N terminal on backbone)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site SalI (not destroyed)
  • 3′ cloning site NotI (not destroyed)
  • 5′ sequencing primer CCAGCAAGTATATAGCATGG
  • 3′ sequencing primer GAGCTGCATGTGTCAGAGG
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pGEX4T-hLIG3 was a gift from Primo Schaer (Addgene plasmid # 81055 ; http://n2t.net/addgene:81055 ; RRID:Addgene_81055)
  • For your References section:

    Biochemical reconstitution of TET1-TDG-BER-dependent active DNA demethylation reveals a highly coordinated mechanism. Weber AR, Krawczyk C, Robertson AB, Kusnierczyk A, Vagbo CB, Schuermann D, Klungland A, Schar P. Nat Commun. 2016 Mar 2;7:10806. doi: 10.1038/ncomms10806. 10.1038/ncomms10806 PubMed 26932196