pRY003
(Plasmid #81043)

• Purpose: HO endonuclease expression
• Depositing Lab: John McCusker
• Publication: McCusker Lab Unpublished Plasmids (unpublished)

Backbone

• Vector backbone: pAG36
• Backbone size w/o insert (bp): 6123
• Modifications to backbone: pAG36 with Gal1/10 promoter added between CEN/ARS and HO added at EcoR1 site
• Vector type: Yeast Expression
• Selectable markers: NAT (select with Nourseothricin/clonNAT)

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: HO
• Promoter: endogenous

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: EcoR1 (unknown if destroyed)
• 3′ cloning site: EcoR1 (unknown if destroyed)
• 5′ sequencing primer: unknown

Resource Information

• Article Citing this Plasmid:
  • 1 Reference

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

The plasmid contains HO with its endogenous promoter amplified from yCP50-HO with oligos :

HO-EcoR1 5'
GCCCTTTCGTCTTCAAGAAT

HO-EcoR1 3'
CCATACCCACGCCGAAACGAATTCAC

Note on YCp50: HO sequence is as published in Meiron et al, Curr Genetics 1995, 367-373. Original source of plasmid may be from reference Jensen et al, 1983, Proc Natl Acad Sci USA 80: 3035-3039.