Skip to main content
Addgene

ARK1a
(Plasmid #81016)

Print

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 81016 Standard format: Plasmid sent in bacteria as agar stab 1 $85
Add to Cart

Backbone

  • Vector backbone
    p15A and ColE1
  • Backbone size w/o insert (bp) 3288
  • Modifications to backbone
    3288bp and 4072bp for each respective backbone
  • Selectable markers
    Ampicillin and Chloramphenicol

Growth in Bacteria

  • Bacterial Resistance(s)
    Chloramphenicol and Ampicillin, 25 & 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH1
  • Growth instructions
    Both Amp and Chlor must be included to maintain the 2 unique plasmids
  • Copy number
    High Copy

Gene/Insert 1

  • Gene/Insert name
    MevTo-BBa1002-pTrc-Mkco-PMKco
  • Insert Size (bp)
    7418
  • Promoter LacUV5 and Trc promoter

Cloning Information for Gene/Insert 1

  • Cloning method Ligation Independent Cloning
  • 5′ sequencing primer cgccgacatcataacggttc
  • 3′ sequencing primer ccgccaggcaaattctgt
    • (Common Sequencing Primers)

Gene/Insert 2

  • Gene/Insert name
    PMD-NudB
  • Insert Size (bp)
    1788
  • Promoter LacUV5 and Trc promoter

Cloning Information for Gene/Insert 2

  • Cloning method Ligation Independent Cloning
  • 5′ sequencing primer cgccgacatcataacggttc
  • 3′ sequencing primer ccgccaggcaaattctgt
    • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    ARK1a was a gift from Taek Soon Lee (Addgene plasmid # 81016 ; http://n2t.net/addgene:81016 ; RRID:Addgene_81016)

  • For your References section:

    Isopentenyl diphosphate (IPP)-bypass mevalonate pathways for isopentenol production. Kang A, George KW, Wang G, Baidoo E, Keasling JD, Lee TS. Metab Eng. 2016 Mar;34:25-35. doi: 10.1016/j.ymben.2015.12.002. Epub 2015 Dec 17. 10.1016/j.ymben.2015.12.002 PubMed 26708516
Related items: