Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

ARK2aa
(Plasmid #81013)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 81013 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    p15A and ColE1
  • Backbone size w/o insert (bp) 3288
  • Modifications to backbone
    3288bp and 4072bp
  • Selectable markers
    Ampicillin and Chloramphenicol

Growth in Bacteria

  • Bacterial Resistance(s)
    Chloramphenicol and Ampicillin, 25 & 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH1
  • Growth instructions
    Both Amp and Chlor must be included to maintain the 2 unique plasmids
  • Copy number
    High Copy

Gene/Insert 1

  • Gene/Insert name
    MevTo-BBa1002-pTrc-Mkco-aphA
  • Insert Size (bp)
    6778
  • Promoter LacUV5 and Trc promoter

Cloning Information for Gene/Insert 1

  • Cloning method Ligation Independent Cloning
  • 5′ sequencing primer cgccgacatcataacggttc
  • 3′ sequencing primer CCGCCAGGCAAATTCTGT
  • (Common Sequencing Primers)

Gene/Insert 2

  • Gene/Insert name
    and PMD
  • Insert Size (bp)
    1309
  • Promoter LacUV5 and Trc promoter

Cloning Information for Gene/Insert 2

  • Cloning method Ligation Independent Cloning
  • 5′ sequencing primer cgccgacatcataacggttc
  • 3′ sequencing primer CCGCCAGGCAAATTCTGT
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    ARK2aa was a gift from Taek Soon Lee (Addgene plasmid # 81013 ; http://n2t.net/addgene:81013 ; RRID:Addgene_81013)
  • For your References section:

    Isopentenyl diphosphate (IPP)-bypass mevalonate pathways for isopentenol production. Kang A, George KW, Wang G, Baidoo E, Keasling JD, Lee TS. Metab Eng. 2016 Mar;34:25-35. doi: 10.1016/j.ymben.2015.12.002. Epub 2015 Dec 17. 10.1016/j.ymben.2015.12.002 PubMed 26708516