-
PurposeExpression of LOV2 anchored to mitochondria
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 81009 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepTriEx
- Backbone size w/o insert (bp) 5040
- Total vector size (bp) 6000
-
Vector typeMammalian Expression, Bacterial Expression, Insect Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameLOV2
-
SpeciesSynthetic
-
Insert Size (bp)432
- Promoter CMV, p10
-
Tag
/ Fusion Protein
- NTOM20 (N terminal on insert)
Cloning Information
- Cloning method Unknown
- 5′ sequencing primer aagtatcgggccctttgtgc
- 3′ sequencing primer GGCAGCCTGCACCTGAGGTTAATCAC
- (Common Sequencing Primers)
Resource Information
-
Articles Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pTriEx-NTOM20-LOV2 was a gift from Klaus Hahn (Addgene plasmid # 81009 ; http://n2t.net/addgene:81009 ; RRID:Addgene_81009) -
For your References section:
LOVTRAP: an optogenetic system for photoinduced protein dissociation. Wang H, Vilela M, Winkler A, Tarnawski M, Schlichting I, Yumerefendi H, Kuhlman B, Liu R, Danuser G, Hahn KM. Nat Methods. 2016 Jul 18. doi: 10.1038/nmeth.3926. 10.1038/nmeth.3926 PubMed 27427858