Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

AAVS1-Pur-CAG-hM4Di-mCherry
(Plasmid #80947)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 80947 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    AAVS1
  • Backbone size w/o insert (bp) 10247
  • Total vector size (bp) 12416
  • Vector type
    Mammalian Expression
  • Selectable markers
    Puromycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    hM4Di-mCherry
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    2169
  • Promoter CAG promoter
  • Tag / Fusion Protein
    • mcherry fusion (C terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site SalI (not destroyed)
  • 3′ cloning site MluI (not destroyed)
  • 5′ sequencing primer ggcttctggcgtgtgaccggc
  • 3′ sequencing primer catagcgtaaaaggagcaaca
  • (Common Sequencing Primers)

Resource Information

  • Supplemental Documents
  • A portion of this plasmid was derived from a plasmid made by
    The hM4Di-mCherry cDNA was amplified from pAAV-hSyn-DIO-hM4D(Gi)-mCherry (addgene #44362, Bryan Roth Lab)

Terms and Licenses

Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    AAVS1-Pur-CAG-hM4Di-mCherry was a gift from Su-Chun Zhang (Addgene plasmid # 80947 ; http://n2t.net/addgene:80947 ; RRID:Addgene_80947)
  • For your References section:

    Chemical Control of Grafted Human PSC-Derived Neurons in a Mouse Model of Parkinson's Disease. Chen Y, Xiong M, Dong Y, Haberman A, Cao J, Liu H, Zhou W, Zhang SC. Cell Stem Cell. 2016 Jun 2;18(6):817-26. doi: 10.1016/j.stem.2016.03.014. Epub 2016 Apr 28. 10.1016/j.stem.2016.03.014 PubMed 27133795