AAVS1-Pur-CAG-mCherry
(Plasmid #80946)

• Purpose: human AAVS1 site targeting donor plasmid for knocking-in mCherry expression cassette driven by CAG promoter
• Depositing Lab: Su-Chun Zhang
• Publication: Chen et al Cell Stem Cell. 2016 Jun 2;18(6):817-26. doi: 10.1016/j.stem.2016.03.014. Epub 2016 Apr 28.

Backbone

• Vector backbone: AAVS1
• Backbone size w/o insert (bp): 10247
• Total vector size (bp): 10958
• Vector type: Mammalian Expression
• Selectable markers: Puromycin

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): NEB Stable
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: mCherry
• Insert Size (bp): 711
• Promoter: CAG promoter

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: SalI (not destroyed)
• 3′ cloning site: MluI (not destroyed)
• 5′ sequencing primer: ggcttctggcgtgtgaccggc
• 3′ sequencing primer: catagcgtaaaaggagcaaca

Resource Information

• Supplemental Documents:
  • AAVS1-Pur-CAG-mCherry Map
• A portion of this plasmid was derived from a plasmid made by: The mCherry was amplified from pAAV-hSyn-DIO-hM4D(Gi)-mCherry (addgene #44362)
• Articles Citing this Plasmid:
  • 6 References

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
  • Takara Bio Limited Use Label License (formerly Clontech)
• Industry Terms:
  • Not Available to Industry