-
Purposeexpresses mouse Piezo1 with GFP
-
Depositing Lab
-
Sequence Information
Ordering
This material is available to academics and nonprofits only.
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 80925 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 | |
Backbone
-
Vector backbonepcDNA3.1
- Total vector size (bp) 14386
-
Modifications to backboneIres-eGFP inserted
-
Vector typeMammalian Expression
-
Selectable markersNeomycin (select with G418)
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberLow Copy
Gene/Insert
-
Gene/Insert namemouse Piezo1 CDS
-
SpeciesM. musculus (mouse)
-
Insert Size (bp)7644
-
Entrez GenePiezo1 (a.k.a. 9630020g22, Fam38a, mKIAA0233)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site NotI (not destroyed)
- 3′ cloning site HindIII (destroyed during cloning)
- 5′ sequencing primer cgcaaatgggcggtaggcgtg (Common Sequencing Primers)
Resource Information
-
Articles Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
How to cite this plasmid
( Back to top)
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
mPiezo1-IRES-eGFP was a gift from Ardem Patapoutian (Addgene plasmid # 80925 ; http://n2t.net/addgene:80925 ; RRID:Addgene_80925) -
For your References section:
Piezo1 and Piezo2 are essential components of distinct mechanically activated cation channels. Coste B, Mathur J, Schmidt M, Earley TJ, Ranade S, Petrus MJ, Dubin AE, Patapoutian A. Science. 2010 Oct 1;330(6000):55-60. doi: 10.1126/science.1193270. Epub 2010 Sep 2. 10.1126/science.1193270 PubMed 20813920
Map uploaded by the depositor.
