pCW57-MCS1-P2A-MCS2 (Blast)
(Plasmid #80921)

• Purpose: (Empty Backbone) All-in-one doxycycline inducible lentiviral vector for expression of one or two genes using the P2A self-cleaving peptide.
• Depositing Lab: Adam Karpf
• Publication: Barger et al Cancers (Basel). 2019 Feb 21;11(2). pii: cancers11020251. doi: 10.3390/cancers11020251.

Backbone

• Vector backbone: pCW57.1
• Backbone manufacturer: Broad Insitute
• Backbone size (bp): 7542
• Modifications to backbone: pCW57-MCS1-2A-MCS2 was modified by replacing puromycin with blasticidin.
• Vector type: Mammalian Expression, Lentiviral ; Doxycycline inducible; P2A Self Cleaving Peptide
• Promoter: TRE
• Selectable markers: Blasticidin

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): NEB Stable
• Copy number: Unknown

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ sequencing primer: pCW57.MCS_Seq_F CGTATGTCGAGGTAGGCGTG

Resource Information

• Articles Citing this Plasmid:
  • 17 References

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Information for Cloning Grade DNA (Catalog # 80921-DNA.cg) ( Back to top)

Purpose

Cloning grade DNA is suitable for use in PCR, cloning reactions, or transformation into E. coli. The purity and amount is not suitable for direct transfections.

Delivery

• Amount: 2 µg
• Guaranteed Concentration: 100 ng/µl +/- 5 ng/µl
• Pricing: $105 USD
• Storage: DNA can be stored at 4℃ (short term) or -20℃ (long term).

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Quality Control

Addgene has verified this plasmid using Next Generation Sequencing. Results are available here