pHD-DsRed-attP-w+
(Plasmid #80898)

• Purpose: Vector for generating dsDNA donors for HDR. Contains an attP docking site, the visible marker 3xP3-DsRed and GMR-white for identifying backbone incorporation.
• Depositing Lab: Kate O'Connor-Giles
• Publication: Kate O'Connor-Giles Lab Donor Plasmids (unpublished)

Backbone

• Vector backbone: pJ204
• Backbone manufacturer: DNA 2.0
• Backbone size w/o insert (bp): 27848
• Total vector size (bp): 7140
• Vector type: high copy, amp resistance

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert 1

• Gene/Insert name: attP
• Species: T4 phage
• Insert Size (bp): 50

Cloning Information for Gene/Insert 1

• Cloning method: Unknown
• 5′ sequencing primer: ACGAAAGGCTCAGTCGAAAG

Gene/Insert 2

• Gene/Insert name: LoxP-3xP3-DsRed-LoxP
• Species: Synthetic
• Insert Size (bp): 1225
• Promoter: 3xP3

Cloning Information for Gene/Insert 2

• Cloning method: Unknown
• 5′ sequencing primer: ACGAAAGGCTCAGTCGAAAG
• 3′ sequencing primer: TGATATCAAAATTATACATGTCAACG

Gene/Insert 3

• Gene/Insert name: GMR-white
• Species: D. melanogaster (fly)
• Insert Size (bp): 2997
• Promoter: GMR::hsp70

Cloning Information for Gene/Insert 3

• Cloning method: Gibson Cloning
• 5′ sequencing primer: GTCTGACGCTCAGTGGAACG
• 3′ sequencing primer: GAGTCAGGCAACTATGGATGAACG

Resource Information

• A portion of this plasmid was derived from a plasmid made by: We had it synthesized by DNA 2.0
• Articles Citing this Plasmid:
  • 5 References

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
  • Takara Bio Limited Use Label License (formerly Clontech)
• Industry Terms:
  • Not Available to Industry