-
Purpose(Empty Backbone) Expression of immunoglobulin light chains in mammalian cells, human lambda 2 constant region
-
Depositing Lab
-
Sequence Information
Ordering
This material is available to academics and nonprofits only.
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 80797 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 | |
Backbone
-
Vector backbonepUC19
- Backbone size (bp) 5018
-
Vector typeMammalian Expression
- Promoter hCMV IE1 gene promoter
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Cloning Information
- Cloning method Restriction Enzyme
- 5′ sequencing primer GCTTCGTTAGAACGCGGCTAC (Common Sequencing Primers)
Resource Information
-
Article Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Annotated sequence available from:
www.ebi.ac.uk/ena
accession number LT615370
How to cite this plasmid
( Back to top)
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
AbVec2.1-IGLC2-MscI was a gift from Hedda Wardemann (Addgene plasmid # 80797 ; http://n2t.net/addgene:80797 ; RRID:Addgene_80797) -
For your References section:
Cloning and expression of murine Ig genes from single B cells. Tiller T, Busse CE, Wardemann H. J Immunol Methods. 2009 Oct 31;350(1-2):183-93. doi: 10.1016/j.jim.2009.08.009. Epub 2009 Aug 27. 10.1016/j.jim.2009.08.009 PubMed 19716372
