peSpCas9(1.1)-2×sgRNA (IFT88, donor)
(Plasmid #80769)

• Purpose: Expresses eSpCas9(1.1) and two sgRNAs. The first gRNA targets human IFT88 and the second gRNA targets a pDonor-tBFP-NLS-Neo (Universal).
• Depositing Lab: Kazuhisa Nakayama
• Publication: Katoh et al Mol Biol Cell. 2017 Feb 8. pii: mbc.E17-01-0051. doi: 10.1091/mbc.E17-01-0051.

Backbone

• Vector backbone: peSpCas9(1.1)-2×sgRNA (empty, donor)
• Backbone manufacturer: Kazuhisa Nakayama Lab. (Addgene plasmid #80768)
• Backbone size w/o insert (bp): 8935
• Total vector size (bp): 8937
• Modifications to backbone: human IFT88 gRNA#1 sequence was inserted in the first sgRNA expression cassette in the plasmid.
• Vector type: Mammalian Expression, CRISPR

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: IFT88 gRNA#1
• gRNA/shRNA sequence: GGGCCCCTTGACTGACTAAG
• Species: H. sapiens (human)
• GenBank ID: NM_175605
• Entrez Gene: IFT88 (a.k.a. D13S1056E, DAF19, TG737, TTC10, hTg737)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: BbsI (destroyed during cloning)
• 3′ cloning site: BbsI (destroyed during cloning)
• 5′ sequencing primer: GCTGGCCTTTTGCTCACATGTG

Resource Information

• Supplemental Documents:
  • peSpCas9(1.1)-2×sgRNA (IFT88, donor).gb

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry