pDonor-tBFP-NLS-Neo (Universal)
(Plasmid #80767)

• Purpose: Universal donor vector for CRISPR/Cas9-mediated homology-independent knock-in system.
• Depositing Lab: Kazuhisa Nakayama
• Publication: Katoh et al Mol Biol Cell. 2017 Feb 8. pii: mbc.E17-01-0051. doi: 10.1091/mbc.E17-01-0051.

Backbone

• Vector backbone: pDonor-tBFP-NLS-Neo
• Backbone manufacturer: Kazuhisa Nakayama Lab. (Addgene plasmid #80766)
• Backbone size w/o insert (bp): 4761
• Total vector size (bp): 4763
• Modifications to backbone: A triplicated nuclear localization signal (NLS) was fused to tBFP. PITCh-gRNA#3 targeting sequence was inserted on upstream of the cytomegalovirus promoter.
• Vector type: Mammalian Expression, CRISPR
• Selectable markers: Neomycin (select with G418)

Growth in Bacteria

• Bacterial Resistance(s): Kanamycin, 50 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: PITCh-gRNA#3 targeting sequence (GCATCGTACGCGTACGTGTT)
• Species: Synthetic
• Insert Size (bp): 20

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: BbsI (destroyed during cloning)
• 3′ cloning site: BbsI (destroyed during cloning)
• 5′ sequencing primer: CACCTCTGACTTGAGCGTCG

Resource Information

• Supplemental Documents:
  • pDonor-tBFP-NLS-Neo (Universal).gb
• Articles Citing this Plasmid:
  • 17 References

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
  • Evrogen Limited Use Label License for FPs
• Industry Terms:
  • Not Available to Industry