Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pESC-NAT-LACap
(Plasmid #80763)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 80763 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pESC-LEU
  • Backbone manufacturer
    Agilent
  • Backbone size w/o insert (bp) 7800
  • Total vector size (bp) 9996
  • Modifications to backbone
    LEU2 cassette replaced by NAT-resistance cassette from pAG25 by short homology directed in vivo replacement.
  • Vector type
    Yeast Expression
  • Selectable markers
    NAT (select with Nourseothricin/clonNAT)

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    L-A cDNA (L-A Cap)
  • Species
    S. cerevisiae (budding yeast)
  • Insert Size (bp)
    2072
  • Promoter PGK1

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site ApaI (not destroyed)
  • 3′ cloning site XhoI (not destroyed)
  • 5′ sequencing primer cattcatataactccccatgc
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

For information on L-A cDNA and its effect on curing of L-A, refer to the following papers:
JOURNAL OF VIROLOGY, Jan. 1991, p. 155-161
JOURNAL OF VIROLOGY, June 1992, p. 3669-3676
JOURNAL OF VIROLOGY, May 1993, P. 2764-2771

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pESC-NAT-LACap was a gift from John McCusker (Addgene plasmid # 80763 ; http://n2t.net/addgene:80763 ; RRID:Addgene_80763)