Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

FLAG_hPPP1R15B_4-713_mCherry_UK1298
(Plasmid #80707)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 80707 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    mCherry_N3
  • Backbone manufacturer
    clonetech
  • Vector type
    Mammalian Expression
  • Selectable markers
    Neomycin (select with G418)

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    human PPP1R15B
  • Alt name
    CReP
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    2145
  • Mutation
    CDS 4-713 no stop codon
  • Entrez Gene
    PPP1R15B (a.k.a. CREP, MSSGM2)
  • Promoter CMV
  • Tag / Fusion Protein
    • mCherry (C terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site HindIII (not destroyed)
  • 3′ cloning site BglII into BamHI (destroyed during cloning)
  • 5′ sequencing primer CGCAAATGGGCGGTAGGCGTG
  • 3′ sequencing primer TGCACCTTGAAGCGCATGAACTC
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    FLAG_hPPP1R15B_4-713_mCherry_UK1298 was a gift from David Ron (Addgene plasmid # 80707 ; http://n2t.net/addgene:80707 ; RRID:Addgene_80707)
  • For your References section:

    G-actin provides substrate-specificity to eukaryotic initiation factor 2alpha holophosphatases. Chen R, Rato C, Yan Y, Crespillo-Casado A, Clarke HJ, Harding HP, Marciniak SJ, Read RJ, Ron D. Elife. 2015 Mar 16;4. doi: 10.7554/eLife.04871. 10.7554/eLife.04871 PubMed 25774600