FLAG_hPPP1R15B_4-713_mCherry_UK1298
(Plasmid #80707)

• Purpose: mammalian expression N-term FLAG and C-term mCherry hPPP1R15B (CReP 4-713)
• Depositing Lab: David Ron
• Publication: Chen et al Elife. 2015 Mar 16;4. doi: 10.7554/eLife.04871.

Backbone

• Vector backbone: mCherry_N3
• Backbone manufacturer: clonetech
• Vector type: Mammalian Expression
• Selectable markers: Neomycin (select with G418)

Growth in Bacteria

• Bacterial Resistance(s): Kanamycin, 50 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: human PPP1R15B
• Alt name: CReP
• Species: H. sapiens (human)
• Insert Size (bp): 2145
• Mutation: CDS 4-713 no stop codon
• Entrez Gene: PPP1R15B (a.k.a. CREP, MSSGM2)
• Promoter: CMV
• Tag / Fusion Protein:
  • mCherry (C terminal on insert)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: HindIII (not destroyed)
• 3′ cloning site: BglII into BamHI (destroyed during cloning)
• 5′ sequencing primer: CGCAAATGGGCGGTAGGCGTG
• 3′ sequencing primer: TGCACCTTGAAGCGCATGAACTC

Resource Information

• Supplemental Documents:
  • FLAG_hPPP1R15B_4-713_mCherry_UK1298.embl
  • FLAG_hPPP1R15B_4-713_mCherry_UK1298
• Article Citing this Plasmid:
  • 1 Reference

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
  • Takara Bio Limited Use Label License (formerly Clontech)
• Industry Terms:
  • Not Available to Industry