pAM-PAT-ProCDKA;1::CDKA;1:YFP
(Plasmid
#80685)
-
Purposebinary Expression vector for plant expression
-
Depositing Labs
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 80685 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backboneBinary vector pAMPAT-MCS
-
Modifications to backboneexchange of Pro35S to ProCDKA;1
-
Vector typePlant Expression
-
Selectable markersBasta
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberLow Copy
Gene/Insert
-
Gene/Insert nameCDKA;1
-
Alt nameCdc2a
-
SpeciesA. thaliana (mustard weed)
-
Entrez GeneCDC2 (a.k.a. AT3G48750, CDC2A, CDC2AAT, CDK2, CDKA1, CDKA;1, CYCLIN-DEPENDENT KINASE A;1, P34CDC2, cell division control 2)
- Promoter ProCDKA;1
-
Tag
/ Fusion Protein
- YFP (C terminal on insert)
Cloning Information
- Cloning method Gateway Cloning
- 5′ sequencing primer gaccggcaacaggattcaatcttaag
- 3′ sequencing primer GAATTAGAAATTTTATTGATAGAAG (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pAM-PAT-ProCDKA;1::CDKA;1:YFP was a gift from Nico Dissmeyer & Arp Schnittger (Addgene plasmid # 80685 ; http://n2t.net/addgene:80685 ; RRID:Addgene_80685) -
For your References section:
Bypassing genomic imprinting allows seed development. Nowack MK, Shirzadi R, Dissmeyer N, Dolf A, Endl E, Grini PE, Schnittger A. Nature. 2007 May 17;447(7142):312-5. Epub 2007 Apr 29. 10.1038/nature05770 PubMed 17468744