pOLENTE
(Plasmid
#80683)
-
Purpose(Empty Backbone) DEST vector for cell-free in vitro expression
-
Depositing Lab
-
Publication
-
Sequence Information
Ordering
This material is available to academics and nonprofits only.
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 80683 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 | |
Backbone
-
Vector backbonepTNT
-
Backbone manufacturerPromega
-
Modifications to backboneGateway reading frame cassette (rfcA) was inserted in multiple cloning site
-
Vector typeMammalian Expression, Synthetic Biology ; in vitro transcription and translation in reticulocyte lysate
- Promoter T7 and SP6
Growth in Bacteria
-
Bacterial Resistance(s)Chloramphenicol and Ampicillin, 25 & 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)ccdB Survival
-
Copy numberHigh Copy
Cloning Information
- Cloning method Gateway Cloning
- 5′ sequencing primer atttaggtgacactata
- 3′ sequencing primer GACACGGAAATGTTGAATAC (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
How to cite this plasmid
( Back to top)
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pOLENTE was a gift from Nico Dissmeyer (Addgene plasmid # 80683 ; http://n2t.net/addgene:80683 ; RRID:Addgene_80683)
