Skip to main content
Addgene

pAM-PAT-35S-GW-Luc
(Plasmid #80678)

Print

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 80678 Standard format: Plasmid sent in bacteria as agar stab 1 $85
Add to Cart

Backbone

  • Vector backbone
    Binary vector pAMPAT-MCS
  • Modifications to backbone
    introduction of firefly Luciferase 3' of Gateway site to create C-terminal fusions
  • Vector type
    Plant Expression
  • Promoter Pro35S
  • Selectable markers
    Basta

Growth in Bacteria

  • Bacterial Resistance(s)
    Chloramphenicol and Ampicillin, 25 & 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DB3.1
  • Growth instructions
    ccdB Survival can also be used for tranformation
  • Copy number
    Low Copy

Cloning Information

  • Cloning method Gateway Cloning
  • 5′ sequencing primer gaccggcaacaggattcaatcttaag
  • 3′ sequencing primer GAATTAGAAATTTTATTGATAGAAG
    • (Common Sequencing Primers)

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    Elke Logemann, Imre Somssich

Terms and Licenses

Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pAM-PAT-35S-GW-Luc was a gift from Nico Dissmeyer & Imre Somssich (Addgene plasmid # 80678 ; http://n2t.net/addgene:80678 ; RRID:Addgene_80678)
Related items:
Commonly requested with: