Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pQLinkHD-SYNZIP4
(Plasmid #80660)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 80660 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pQE-2
  • Backbone manufacturer
    Qiagen
  • Backbone size w/o insert (bp) 4892
  • Vector type
    Bacterial Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    SYNZIP4
  • Species
    Synthetic
  • Insert Size (bp)
    165
  • Tag / Fusion Protein
    • 6xHis (N terminal on insert)

Cloning Information

  • Cloning method Gateway Cloning
  • 5′ sequencing primer pQE65, TGAGCGGATAACAATTTCACACAG
  • 3′ sequencing primer pQE276, GGCAACCGAGCGTTCTGAAC
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pQLinkHD-SYNZIP4 was a gift from Amy Keating (Addgene plasmid # 80660 ; http://n2t.net/addgene:80660 ; RRID:Addgene_80660)
  • For your References section:

    SYNZIP protein interaction toolbox: in vitro and in vivo specifications of heterospecific coiled-coil interaction domains. Thompson KE, Bashor CJ, Lim WA, Keating AE. ACS Synth Biol. 2012 Apr 20;1(4):118-29. 10.1021/sb200015u PubMed 22558529