pQLinkHD-SYNZIP1
(Plasmid #80647)

• Purpose: Encodes the synthetic coiled coil peptide SYNZIP1
• Depositing Lab: Amy Keating
• Publication: Thompson et al ACS Synth Biol. 2012 Apr 20;1(4):118-29.

Backbone

• Vector backbone: pQE-2
• Backbone manufacturer: Qiagen
• Backbone size w/o insert (bp): 4892
• Vector type: Bacterial Expression

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: Unknown

Gene/Insert

• Gene/Insert name: SYNZIP1
• Species: Synthetic
• Insert Size (bp): 144
• Tag / Fusion Protein:
  • 6xHis (N terminal on insert)

Cloning Information

• Cloning method: Gateway Cloning
• 5′ sequencing primer: pQE65, TGAGCGGATAACAATTTCACACAG
• 3′ sequencing primer: pQE276, GGCAACCGAGCGTTCTGAAC

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

Addgene's NGS results indicate that two copies of SYNZIP1 are present in this plasmid. This plasmid also contains CmR and KanR resistance genes for which functionality not been tested.