-
PurposeFluorescent destablizing domain for regulating protein stability and fluorescence
-
Depositing Lab
-
Publication
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 80629 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepBMN
-
Backbone manufacturerGary Nolan
- Backbone size w/o insert (bp) 6940
- Total vector size (bp) 7190
-
Modifications to backboneBlastcidin-S resistanct gene (bsr) behind IRES
-
Vector typeRetroviral
-
Selectable markersBlasticidin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature30°C
-
Growth Strain(s)NEB Stable
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameUnaG
-
SpeciesAnguilla japonica
-
Insert Size (bp)1216
-
Mutationmutations A36V, R136G
-
GenBank IDAB763906
- Promoter LTR
-
Tag
/ Fusion Protein
- HA-mcherry-linker (N terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BamHI (not destroyed)
- 3′ cloning site NotI (not destroyed)
- 5′ sequencing primer Lab32 ATCGCAGCTTGGATACACGCC
- 3′ sequencing primer LC54 CATATAGACAAACGCACACCGGCCTTA (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
mCherry-FDD was a gift from Thomas Wandless (Addgene plasmid # 80629 ; http://n2t.net/addgene:80629 ; RRID:Addgene_80629) -
For your References section:
A Novel Destabilizing Domain Based on a Small-Molecule Dependent Fluorophore. Navarro R, Chen LC, Rakhit R, Wandless TJ. ACS Chem Biol. 2016 Jun 6. 10.1021/acschembio.6b00234 PubMed 27243964