NLS-AgDD
(Plasmid #80625)

• Purpose: create nuclear protein aggregates in mammalian cells
• Depositing Lab: Thomas Wandless
• Publication: Miyazaki et al Nat Commun. 2016 May 27;7:11689. doi: 10.1038/ncomms11689.

Backbone

• Vector backbone: PiggyBac transformation vector pB
• Backbone size w/o insert (bp): 6652
• Total vector size (bp): 7763
• Vector type: Mammalian Expression

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: NLS-NES-L106P-sfGFP
• Alt name: NLS-AgDD
• Species: H. sapiens (human)
• Insert Size (bp): 1113
• GenBank ID: NM_000801 AB971579
• Entrez Gene: FKBP1A (a.k.a. FKBP-12, FKBP-1A, FKBP1, FKBP12, PKC12, PKCI2, PPIASE)
• Tag / Fusion Protein:
  • MPPKKKRKVLALKLAGLDI (N terminal on insert)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: EcoRI (not destroyed)
• 3′ cloning site: HpaI (not destroyed)
• 5′ sequencing primer: YM213--5' atgccttcttctttttcctacagct
• 3′ sequencing primer: YM215--5' gatgagtttggacaaaccacaact

Resource Information

• Articles Citing this Plasmid:
  • 2 References

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
  • piggyBac Limited Use Label License
• Industry Terms:
  • Not Available to Industry

Depositor Comments

Depositor reference sequence and Addgene Sanger results show F36V compared to NM_000801.4.