pBIG2abcd
(Plasmid
#80618)
-
Purpose(Empty Backbone) pBIG2abcd - Step2 vector abcd (biGBac system for expression of protein complexes in insect cells)
-
Depositing Lab
-
Sequence Information
Full plasmid sequence is not available for this item.
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 80618 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepBIG2abcd
- Backbone size (bp) 5669
-
Vector typeInsect Expression
-
Selectable markersGentamicin
Growth in Bacteria
-
Bacterial Resistance(s)Chloramphenicol and Ampicillin, 25 & 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer TCAACAGGTTGAACTGCTGATC
- 3′ sequencing primer GGTGTAGCGTCGTAAGCTAATAC (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pBIG2abcd was a gift from Jan-Michael Peters (Addgene plasmid # 80618 ; http://n2t.net/addgene:80618 ; RRID:Addgene_80618) -
For your References section:
biGBac enables rapid gene assembly for the expression of large multisubunit protein complexes. Weissmann F, Petzold G, VanderLinden R, Huis In 't Veld PJ, Brown NG, Lampert F, Westermann S, Stark H, Schulman BA, Peters JM. Proc Natl Acad Sci U S A. 2016 May 10;113(19):E2564-9. doi: 10.1073/pnas.1604935113. Epub 2016 Apr 25. 10.1073/pnas.1604935113 PubMed 27114506