Skip to main content
Addgene

pcDNA3-FLAG-VSVG
(Plasmid #80606)

Print

Ordering

This material is available to academics and nonprofits only. Orders shipped outside the U.S. may require additional regulatory approval, as well as a non-refundable export license fee of $85. Please log in to view availability.
Item Catalog # Description Quantity Price (USD)
Plasmid 80606 Standard format: Plasmid sent in bacteria as agar stab 1 $85
Add to Cart

Backbone

  • Vector backbone
    pcDNA3.1
  • Backbone manufacturer
    Life Technologies
  • Backbone size w/o insert (bp) 5349
  • Total vector size (bp) 6939
  • Vector type
    Mammalian Expression
  • Selectable markers
    Neomycin (select with G418)

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    VSV-G
  • Alt name
    Vesicular Stomatitis Virus Glycoprotein
  • Species
    Vesicular Stomatitis Virus
  • Insert Size (bp)
    1590
  • Promoter CMV
  • Tag / Fusion Protein
    • FLAG (N terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site NheI (not destroyed)
  • 3′ cloning site XbaI (not destroyed)
  • 5′ sequencing primer GAACCCACTGCTTACTGGC
  • 3′ sequencing primer GTCGAGGCTGATCAGCGAGC
    • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pcDNA3-FLAG-VSVG was a gift from Sven Eyckerman (Addgene plasmid # 80606 ; http://n2t.net/addgene:80606 ; RRID:Addgene_80606)

  • For your References section:

    Trapping mammalian protein complexes in viral particles. Eyckerman S, Titeca K, Van Quickelberghe E, Cloots E, Verhee A, Samyn N, De Ceuninck L, Timmerman E, De Sutter D, Lievens S, Van Calenbergh S, Gevaert K, Tavernier J. Nat Commun. 2016 Apr 28;7:11416. doi: 10.1038/ncomms11416. 10.1038/ncomms11416 PubMed 27122307
Related items:
Commonly requested with: