Skip to main content
Addgene

pMET7-GAG-HRAS
(Plasmid #80604)

Print

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 80604 Standard format: Plasmid sent in bacteria as agar stab 1 $85
Add to Cart

Backbone

  • Vector backbone
    pMET7
  • Backbone manufacturer
    -
  • Backbone size w/o insert (bp) 2967
  • Total vector size (bp) 5050
  • Vector type
    Mammalian Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    HIV-1 p55 GAG
  • Alt name
    GAG
  • Species
    HIV-1
  • Insert Size (bp)
    1500
  • Promoter SRalpha

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site ApaI (destroyed during cloning)
  • 3′ cloning site EcoRI (not destroyed)
  • 5′ sequencing primer ATCAAAGAACTGCTCCTC
  • 3′ sequencing primer GTAACCATTATAAGCTGCAA
    • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

This plasmid contains a fusion insert (HIV-1 GAG and human HRAS). Researchers interested in using the system will need to replace the HRAS with their cDNA of interest. Note: The HRAS insert is missing aa 181-189 (stops at aa 180).

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pMET7-GAG-HRAS was a gift from Sven Eyckerman (Addgene plasmid # 80604 ; http://n2t.net/addgene:80604 ; RRID:Addgene_80604)

  • For your References section:

    Trapping mammalian protein complexes in viral particles. Eyckerman S, Titeca K, Van Quickelberghe E, Cloots E, Verhee A, Samyn N, De Ceuninck L, Timmerman E, De Sutter D, Lievens S, Van Calenbergh S, Gevaert K, Tavernier J. Nat Commun. 2016 Apr 28;7:11416. doi: 10.1038/ncomms11416. 10.1038/ncomms11416 PubMed 27122307
Related items:
Commonly requested with: