pLenti6-DCX-EGFP
(Plasmid #80599)

• Purpose: pLenti6 destination vector encoding C-terminally EGFP-tagged human doublecortin (DCX; GenBank: NM_178152)
• Depositing Lab: Torsten Wittmann
• Publication: Ettinger et al Curr Biol. 2016 Jun 20;26(12):1549-55. doi: 10.1016/j.cub.2016.04.020. Epub 2016 May 26.

Backbone

• Vector backbone: pLenti6/V5-DEST
• Backbone manufacturer: Invitrogen
• Backbone size w/o insert (bp): 8500
• Total vector size (bp): 9019
• Vector type: Lentiviral
• Selectable markers: Blasticidin

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): Stbl3
• Copy number: Unknown

Gene/Insert

• Gene/Insert name: Doublecortin
• Alt name: DCX
• Species: H. sapiens (human)
• Insert Size (bp): 1095
• GenBank ID: NM_178152
• Entrez Gene: DCX (a.k.a. DBCN, DC, LISX, SCLH, XLIS)
• Promoter: CMV
• Tag / Fusion Protein:
  • EGFP (C terminal on insert)

Cloning Information

• Cloning method: Gateway Cloning
• 5′ sequencing primer: CMV forward (CGCAAATGGGCGGTAGGCGTG)
• 3′ sequencing primer: EGFP N reverse (cgtcgccgtccagctcgaccag)

Resource Information

• A portion of this plasmid was derived from a plasmid made by: The original DCX sequence comes from Addgene Plasmid #32851
• Article Citing this Plasmid:
  • 1 Reference

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry