-
PurposeAAVS1 sgRNA expression vector
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 80494 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepX330
- Total vector size (bp) 8509
-
Vector typeMammalian Expression, CRISPR
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameAAVS1 sgRNA-T2
-
gRNA/shRNA sequenceggggccactagggacaggat
-
SpeciesH. sapiens (human), Synthetic
- Promoter U6
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BbsI (destroyed during cloning)
- 3′ cloning site BbsI (destroyed during cloning)
- 5′ sequencing primer 5'-GAGGGCCTATTTCCCATGATTCC-3' (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
-
Articles Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pXAT2 was a gift from Knut Woltjen (Addgene plasmid # 80494 ; http://n2t.net/addgene:80494 ; RRID:Addgene_80494) -
For your References section:
Engineering the AAVS1 locus for consistent and scalable transgene expression in human iPSCs and their differentiated derivatives. Oceguera-Yanez F, Kim SI, Matsumoto T, Tan GW, Xiang L, Hatani T, Kondo T, Ikeya M, Yoshida Y, Inoue H, Woltjen K. Methods. 2015 Dec 18. pii: S1046-2023(15)30181-X. doi: 10.1016/j.ymeth.2015.12.012. 10.1016/j.ymeth.2015.12.012 PubMed 26707206