pmCherry_gRNA
(Plasmid #80457)

• Purpose: gRNA expression vector with mCherry transfection control
• Depositing Lab: Ervin Welker
• Publication: Kulcsar et al Genome Biol. 2017 Oct 6;18(1):190. doi: 10.1186/s13059-017-1318-8.

Backbone

• Vector backbone: pEGFP-C1
• Backbone manufacturer: Clonetech
• Backbone size w/o insert (bp): 2871
• Total vector size (bp): 5033
• Vector type: Mammalian Expression, CRISPR

Growth in Bacteria

• Bacterial Resistance(s): Kanamycin, 50 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert 1

• Gene/Insert name: sp Cas9 gRNA
• Alt name: Streptococcus pyogenes guideRNA
• Species: Streptococcus pyogenes
• Insert Size (bp): 76
• Promoter: U6

Cloning Information for Gene/Insert 1

• Cloning method: Unknown
• 5′ sequencing primer: CCTCTGACTTGAGCGTCG
• 3′ sequencing primer: AGTAGGAAAGTCCCGTAAGG

Gene/Insert 2

• Gene/Insert name: mCherry
• Insert Size (bp): 717
• Promoter: chicken β-actin promoter

Cloning Information for Gene/Insert 2

• Cloning method: Unknown
• 5′ sequencing primer: aagggatggttggttggtgg
• 3′ sequencing primer: CCTTTCTCGCCACGTTCG

Resource Information

• Supplemental Documents:
  • pmCherry_gRNA GenBank
• Articles Citing this Plasmid:
  • 6 References

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
  • Takara Bio Limited Use Label License (formerly Clontech)
• Industry Terms:
  • Not Available to Industry