pSc1-DD
(Plasmid #80439)

• Purpose: Expresses eGFP with ecDHFR along with an U6 promoter driven gRNA which cleaves the plasmid in-cell
• Depositing Lab: Ervin Welker
• Publication: Talas et al DNA Res. 2017 Jun 30. doi: 10.1093/dnares/dsx029.

Backbone

• Vector backbone: pEGFP-C1
• Backbone manufacturer: Clonetech
• Backbone size w/o insert (bp): 4731
• Total vector size (bp): 5638
• Vector type: Mammalian Expression, CRISPR
• Selectable markers: Neomycin (select with G418)

Growth in Bacteria

• Bacterial Resistance(s): Kanamycin, 50 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert 1

• Gene/Insert name: sp Cas9 gRNA
• Alt name: Streptococcus pyogenes guideRNA
• Species: Streptococcus pyogenes
• Insert Size (bp): 76
• Promoter: U6

Cloning Information for Gene/Insert 1

• Cloning method: Gibson Cloning
• 5′ sequencing primer: ACCGCTTCCTCGTGCTTTAC
• 3′ sequencing primer: CACGTTAAGGGATTTTGGTCA

Gene/Insert 2

• Gene/Insert name: eGFP
• Alt name: enhanced green fluorescent protein
• Insert Size (bp): 717
• Promoter: CMV
• Tag / Fusion Protein:
  • E. coli dihydrofolate reductase (N terminal on insert)

Cloning Information for Gene/Insert 2

• Cloning method: Unknown
• 5′ sequencing primer: CAACGGGACTTTCCAAAATG
• 3′ sequencing primer: AGCTGCAATAAACAAGTT

Resource Information

• Supplemental Documents:
  • pSc1-DD GenBank
• Articles Citing this Plasmid:
  • 2 References

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry