-
PurposeMembrane localized GFP-tagged LOVpep. Expresses in mammalian cells
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 80406 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backboneunknown
- Backbone size w/o insert (bp) 5183
- Total vector size (bp) 7235
-
Vector typeMammalian Expression
-
Selectable markersZeocin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameStargazin-GFP-LOVpep
-
SpeciesH. sapiens (human)
-
Insert Size (bp)2412
-
Entrez GeneCACNG2 (a.k.a. MRD10)
- Promoter CMV
-
Tag
/ Fusion Protein
- GFP
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer GATGGGGCTGTTTGATCGAGGTG
- 3′ sequencing primer AAACGGGCCCTCTAGgtgacataactaattacatgactcgaG (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
-
Articles Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
Stargazin-GFP-LOVpep was a gift from Michael Glotzer (Addgene plasmid # 80406 ; http://n2t.net/addgene:80406 ; RRID:Addgene_80406) -
For your References section:
Local RhoA activation induces cytokinetic furrows independent of spindle position and cell cycle stage. Wagner E, Glotzer M. J Cell Biol. 2016 Jun 20;213(6):641-9. doi: 10.1083/jcb.201603025. Epub 2016 Jun 13. 10.1083/jcb.201603025 PubMed 27298323