pSKA413
(Plasmid #80381)

• Purpose: Constitutive CcaS and CcaR with gfpmut3 under the cpcG2Δ59 promoter.
• Depositing Lab: Mustafa Khammash
• Publication: Milias-Argeitis et al Nat Commun. 2016 Aug 26;7:12546. doi: 10.1038/ncomms12546.

Backbone

• Vector backbone: pZE31
• Backbone manufacturer: Lutz and Bujard. 1997. Nucleic Acids Research, 25: 1203-1210.
• Backbone size w/o insert (bp): 2000
• Total vector size (bp): 5859
• Vector type: Bacterial Expression, Synthetic Biology ; Optogenetics

Growth in Bacteria

• Bacterial Resistance(s): Chloramphenicol, 25 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert 1

• Gene/Insert name: ccaS (complement)
• Alt name: green-light sensing histidine kinase
• Species: Synechocystis sp. PCC6803
• Insert Size (bp): 2259
• Promoter: ccaR
• Tag / Fusion Protein:
  • FLAG tag (C terminal on insert)

Cloning Information for Gene/Insert 1

• Cloning method: Gibson Cloning
• 5′ sequencing primer: GTTGTGCAACGTGCCAAC
• 3′ sequencing primer: GTGAAAGTTGGAACCTCTTACG

Gene/Insert 2

• Gene/Insert name: ccaR (complement)
• Alt name: response regulator
• Species: Synechocystis sp. PCC6803
• Insert Size (bp): 702
• Promoter: ccaR
• Tag / Fusion Protein:
  • FLAG tag (C terminal on insert)

Cloning Information for Gene/Insert 2

• Cloning method: Gibson Cloning
• 5′ sequencing primer: GTGAAAAGTTCTTCTCCTTTACGC

Gene/Insert 3

• Gene/Insert name: gfpmut3
• Alt name: green fluorescent variant
• Species: A. victoria
• Insert Size (bp): 717
• Promoter: cpcG2Δ59

Cloning Information for Gene/Insert 3

• Cloning method: Gibson Cloning
• 5′ sequencing primer: GGCAATATCAACGGTGTAAAGC
• 3′ sequencing primer: CTTTGAGTGAGCTGATACCG

Resource Information

• Supplemental Documents:
  • pSKA413 annotated GenBank file

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry