pCFJ150-atg4.2
(Plasmid
#80352)
-
PurposePmex-5:GFP::H2B::PEST::atg4.2 3'UTR reporter construct used for microinjection
-
Depositing Lab
-
Sequence Information
Full plasmid sequence is not available for this item.
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 80352 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepCFJ150
-
Vector typeWorm Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert namePmex-5:GFP::H2B::PEST::atg4.2 3'UTR
-
SpeciesC. elegans (nematode)
Cloning Information
- Cloning method Gateway Cloning
- 5′ sequencing primer TTCGCTGTCCTGTCACACTC
- 3′ sequencing primer TTCGCTGTCCTGTCACACTC (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pCFJ150-atg4.2 was a gift from Sean Ryder (Addgene plasmid # 80352 ; http://n2t.net/addgene:80352 ; RRID:Addgene_80352) -
For your References section:
Efficient generation of transgenic reporter strains and analysis of expression patterns in Caenorhabditis elegans using Library MosSCI. Kaymak E, Farley BM, Hay SA, Li C, Ho S, Hartman DJ, Ryder SP. Dev Dyn. 2016 Jun 13. doi: 10.1002/dvdy.24426. 10.1002/dvdy.24426 PubMed 27294288