Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pCFJ150-atg4.2
(Plasmid #80352)

Full plasmid sequence is not available for this item.

Loading...

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 80352 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pCFJ150
  • Vector type
    Worm Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    Pmex-5:GFP::H2B::PEST::atg4.2 3'UTR
  • Species
    C. elegans (nematode)

Cloning Information

  • Cloning method Gateway Cloning
  • 5′ sequencing primer TTCGCTGTCCTGTCACACTC
  • 3′ sequencing primer TTCGCTGTCCTGTCACACTC
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pCFJ150-atg4.2 was a gift from Sean Ryder (Addgene plasmid # 80352 ; http://n2t.net/addgene:80352 ; RRID:Addgene_80352)
  • For your References section:

    Efficient generation of transgenic reporter strains and analysis of expression patterns in Caenorhabditis elegans using Library MosSCI. Kaymak E, Farley BM, Hay SA, Li C, Ho S, Hartman DJ, Ryder SP. Dev Dyn. 2016 Jun 13. doi: 10.1002/dvdy.24426. 10.1002/dvdy.24426 PubMed 27294288