pLenti-smURFP
(Plasmid #80349)

• Purpose: Lentiviral transfer vector under the CMV promoter that expresses smURFP.
• Depositing Labs: Erik Rodriguez, Roger Tsien
• Publication: Rodriguez et al Nat Methods. 2016 Aug 1. doi: 10.1038/nmeth.3935.

Backbone

• Vector backbone: pLenti
• Backbone manufacturer: Deisseroth / Boyden lab
• Backbone size w/o insert (bp): 8614
• Total vector size (bp): 9016
• Modifications to backbone: Lentiviral transfer vector (2nd Generation) under CMV promoter
• Vector type: Lentiviral

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 30°C
• Growth Strain(s): NEB Stable
• Growth instructions: Any growth strain that avoids recombination and 30 ˚C is recommended to avoid loss of DNA upon propagation.
• Copy number: Low Copy

Gene/Insert

• Gene/Insert name: smURFP
• Alt name: small Ultra-Red Fluorescent Protein
• Species: Synthetic
• Insert Size (bp): 402
• GenBank ID: KX449134
• Promoter: CMV

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: BamHI (not destroyed)
• 3′ cloning site: EcoRI (not destroyed)
• 5′ sequencing primer: taatacgactcactataggg
• 3′ sequencing primer: Unnecessary

Resource Information

• Article Citing this Plasmid:
  • 1 Reference

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry