pLenti-smURFP-T2A-mCherry
(Plasmid #80347)

• Purpose: Lentiviral transfer vector under the CMV promoter that expresses smURFP and mCherry.
• Depositing Labs: Erik Rodriguez, Roger Tsien
• Publication: Rodriguez et al Nat Methods. 2016 Aug 1. doi: 10.1038/nmeth.3935.

Backbone

• Vector backbone: pLenti
• Backbone manufacturer: Deisseroth / Boyden lab
• Backbone size w/o insert (bp): 9412
• Total vector size (bp): 9811
• Modifications to backbone: Lentiviral transfer vector (2nd Generation) under the CMV promoter that expresses smURFP and mCherry.
• Vector type: Lentiviral

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 30°C
• Growth Strain(s): Stbl3
• Growth instructions: Any growth strain that avoids recombination and 30 ˚C is recommended to avoid loss of DNA upon propagation
• Copy number: Low Copy

Gene/Insert 1

• Gene/Insert name: smURFP
• Alt name: small Ultra-Red Fluorescent Protein
• Species: Synthetic
• Insert Size (bp): 399
• GenBank ID: KX449134
• Promoter: CMV

Cloning Information for Gene/Insert 1

• Cloning method: Restriction Enzyme
• 5′ cloning site: BamHI (not destroyed)
• 3′ cloning site: NheI (not destroyed)
• 5′ sequencing primer: TAATACGACTCACTATAGGG
• 3′ sequencing primer: Unnecessary

Gene/Insert 2

• Gene/Insert name: mCherry
• Alt name: monomeric Cherry fluorescent protein
• Species: Synthetic
• Insert Size (bp): 711
• GenBank ID: AY678264
• Promoter: CMV

Cloning Information for Gene/Insert 2

• Cloning method: Restriction Enzyme
• 5′ cloning site: BsiWI (not destroyed)
• 3′ cloning site: EcoRI (not destroyed)
• 5′ sequencing primer: GGAGAATCCCGGCCCT
• 3′ sequencing primer: CCAGTCAATCTTTCACAAATTTTGTAATCCAGAGG

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
  • Takara Bio Limited Use Label License (formerly Clontech)
• Industry Terms:
  • Not Available to Industry