pcDNA3-TDsmURFP-IRES-HO-1
(Plasmid #80346)

• Purpose: Expresses Tandem Dimer smURFP and Heme Oxygenase-1 in mammalian cells.
• Depositing Labs: Erik Rodriguez, Roger Tsien
• Publication: Rodriguez et al Nat Methods. 2016 Aug 1. doi: 10.1038/nmeth.3935.

Backbone

• Vector backbone: pcDNA3
• Backbone manufacturer: Thermo Fisher
• Backbone size w/o insert (bp): 6845
• Total vector size (bp): 7715
• Vector type: Mammalian Expression
• Selectable markers: Hygromycin

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert 1

• Gene/Insert name: Tandem Dimer smURFP
• Alt name: Tandem Dimer small Ultra-Red Fluorescent Protein
• Species: Synthetic
• Insert Size (bp): 870
• GenBank ID: KX449135
• Promoter: CMV

Cloning Information for Gene/Insert 1

• Cloning method: Restriction Enzyme
• 5′ cloning site: HindII (not destroyed)
• 3′ cloning site: XhoI (not destroyed)
• 5′ sequencing primer: TAATACGACTCACTATAGGG
• 3′ sequencing primer: GGCGTACAAGGGTACCGC

Gene/Insert 2

• Gene/Insert name: HO-1
• Alt name: Heme Oxygenase-1
• Species: Synechocystis
• Insert Size (bp): 723
• Promoter: IRES

Cloning Information for Gene/Insert 2

• Cloning method: Restriction Enzyme
• 5′ cloning site: BsiWI (not destroyed)
• 3′ cloning site: XbaI (not destroyed)
• 5′ sequencing primer: gtggctgcttatggtgacaatc
• 3′ sequencing primer: CCTCGACTGTGCCTTCTA

Resource Information

• A portion of this plasmid was derived from a plasmid made by: All constructs with HO-1 was initially obtained from Professor J. Clark Lagarias (University of California, Davis).

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry