pBAD-TDsmURFP-RBS-HO-1
(Plasmid #80342)

• Purpose: Expresses Tandem Dimer smURFP and Heme Oxygenase-1 in bacterial cells.
• Depositing Labs: Erik Rodriguez, Roger Tsien
• Publication: Rodriguez et al Nat Methods. 2016 Aug 1. doi: 10.1038/nmeth.3935.

Backbone

• Vector backbone: pBAD
• Backbone manufacturer: Life Technlogies
• Backbone size w/o insert (bp): 4740
• Total vector size (bp): 5628
• Modifications to backbone: Contains Ribosomal Binding Site for expression of both TDsmURFP and HO-1.
• Vector type: Bacterial Expression

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Growth instructions: For smURFP and HO-1 expression, arabinose is required.
• Copy number: High Copy

Gene/Insert 1

• Gene/Insert name: Tandem Dimer smURFP
• Alt name: Tandem Dimer small Ultra-Red Fluorescent Protein
• Species: Synthetic
• Insert Size (bp): 888
• GenBank ID: KX449135
• Promoter: pBAD
• Tag / Fusion Protein:
  • 6 Histidine Tag (C terminal on backbone)

Cloning Information for Gene/Insert 1

• Cloning method: Restriction Enzyme
• 5′ cloning site: BamHI (not destroyed)
• 3′ cloning site: EcoRI (not destroyed)
• 5′ sequencing primer: ATGCCATAGCATTTTTATCC
• 3′ sequencing primer: CCCatgagtgtcaacttagcttccc

Gene/Insert 2

• Gene/Insert name: HO-1
• Alt name: Heme Oxygenase-1
• Species: Synechocystis
• Promoter: pBAD

Cloning Information for Gene/Insert 2

• Cloning method: Unknown
• 5′ sequencing primer: GGCTATGTCCGAATTCCATCATC
• 3′ sequencing primer: GATTTAATCTGTATCAGG

Resource Information

• A portion of this plasmid was derived from a plasmid made by: All constructs with HO-1 was initially obtained from Professor J. Clark Lagarias (University of California, Davis).
• Article Citing this Plasmid:
  • 1 Reference

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry