Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pBAD-TDsmURFP-RBS-HO-1
(Plasmid #80342)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 80342 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pBAD
  • Backbone manufacturer
    Life Technlogies
  • Backbone size w/o insert (bp) 4740
  • Total vector size (bp) 5628
  • Modifications to backbone
    Contains Ribosomal Binding Site for expression of both TDsmURFP and HO-1.
  • Vector type
    Bacterial Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Growth instructions
    For smURFP and HO-1 expression, arabinose is required.
  • Copy number
    High Copy

Gene/Insert 1

  • Gene/Insert name
    Tandem Dimer smURFP
  • Alt name
    Tandem Dimer small Ultra-Red Fluorescent Protein
  • Species
    Synthetic
  • Insert Size (bp)
    888
  • GenBank ID
    KX449135
  • Promoter pBAD
  • Tag / Fusion Protein
    • 6 Histidine Tag (C terminal on backbone)

Cloning Information for Gene/Insert 1

  • Cloning method Restriction Enzyme
  • 5′ cloning site BamHI (not destroyed)
  • 3′ cloning site EcoRI (not destroyed)
  • 5′ sequencing primer ATGCCATAGCATTTTTATCC
  • 3′ sequencing primer CCCatgagtgtcaacttagcttccc
  • (Common Sequencing Primers)

Gene/Insert 2

  • Gene/Insert name
    HO-1
  • Alt name
    Heme Oxygenase-1
  • Species
    Synechocystis
  • Promoter pBAD

Cloning Information for Gene/Insert 2

  • Cloning method Unknown
  • 5′ sequencing primer GGCTATGTCCGAATTCCATCATC
  • 3′ sequencing primer GATTTAATCTGTATCAGG
  • (Common Sequencing Primers)

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    All constructs with HO-1 was initially obtained from Professor J. Clark Lagarias (University of California, Davis).
  • Article Citing this Plasmid

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pBAD-TDsmURFP-RBS-HO-1 was a gift from Erik Rodriguez & Roger Tsien (Addgene plasmid # 80342 ; http://n2t.net/addgene:80342 ; RRID:Addgene_80342)
  • For your References section:

    A far-red fluorescent protein evolved from a cyanobacterial phycobiliprotein. Rodriguez EA, Tran GN, Gross LA, Crisp JL, Shu X, Lin JY, Tsien RY. Nat Methods. 2016 Aug 1. doi: 10.1038/nmeth.3935. 10.1038/nmeth.3935 PubMed 27479328